View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17591_low_15 (Length: 255)
Name: NF17591_low_15
Description: NF17591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17591_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 10 - 237
Target Start/End: Complemental strand, 25743128 - 25742906
Alignment:
| Q |
10 |
agatgaacatattgcgggaaagcattggttgtctgtacaatttggaaactttgaaactagttggatgtactaacctacaagaacttcctaaagattttca |
109 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
25743128 |
agatgaacatattgcgggaaagcatcggttgtctgtacaatttggaaactttgaagctagttggatgtactaacctacaa-----tcctaaagattttca |
25743034 |
T |
|
| Q |
110 |
taggttagttaacctgcgttacttagatattacttgtacgagtttgaaatggatgccattgcatttatgtgcattgacaaacctacaaaaactaagtgac |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25743033 |
taggttagttaacctgcgttacttagatattacttgtacgagtttgaaatggatgccattgcatttatgtgcattgacaaacctacaaaaactaagtgac |
25742934 |
T |
|
| Q |
210 |
tttttcataggaaaagaatatggatctt |
237 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
25742933 |
tttttcataggaaaagaatatggatctt |
25742906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University