View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17591_low_16 (Length: 243)
Name: NF17591_low_16
Description: NF17591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17591_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 9 - 140
Target Start/End: Original strand, 52710716 - 52710847
Alignment:
| Q |
9 |
actctgaagtctgaactcagccatagtgatattgatacattcatattataatttcttaaacgattggtttatagcagttgtctttaaaatgatggggttt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52710716 |
actctgaagtctgaactcagccatagtgatattgatacattcatattataatttcttaaacgattggtttatagcagttgtctttaaaatgatggggttt |
52710815 |
T |
|
| Q |
109 |
attccttaaaaacctattaaagcaattttctt |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
52710816 |
attccttaaaaacctattaaagcaattttctt |
52710847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 202 - 241
Target Start/End: Original strand, 52710907 - 52710946
Alignment:
| Q |
202 |
ttagcttcatcttttggctcttgaaataaatttttaaata |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52710907 |
ttagcttcatcttttggctcttgaaataaatttttaaata |
52710946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University