View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17591_low_7 (Length: 328)
Name: NF17591_low_7
Description: NF17591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17591_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 178 - 293
Target Start/End: Complemental strand, 28765345 - 28765233
Alignment:
| Q |
178 |
tatcgtttgaggacgagcaatgtttaagtcttagatcacccttagtttaatgaagcctttgagtgaaatgcatgacctacttcttatatgtgtctattta |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28765345 |
tatcgtttgaggacgagcaatgtttaagtcttagatcacccttagtttaatgaagcctttgagtgaaatgcatgaccta---cttatatgtgtctattta |
28765249 |
T |
|
| Q |
278 |
gttgttgtgataatag |
293 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
28765248 |
gttgttgtgataatag |
28765233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 28765496 - 28765439
Alignment:
| Q |
27 |
caagacgcatattaatatatgctacgtattggaatagattgtgtggtgtcccggacag |
84 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| ||||||||||| ||||| |
|
|
| T |
28765496 |
caagacgcatattaatatatgctacgtatcggaatagattttgtggtgtcccagacag |
28765439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 220 - 277
Target Start/End: Original strand, 28854732 - 28854788
Alignment:
| Q |
220 |
tagtttaatgaagcctttgagtgaaatgcatgacctacttcttatatgtgtctattta |
277 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||| |||||| | ||||| |||||| |
|
|
| T |
28854732 |
tagtttaatgaagcctttgagtg-aatgcatggcctccttcttgtttgtgtttattta |
28854788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University