View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17593_high_4 (Length: 212)
Name: NF17593_high_4
Description: NF17593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17593_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 14 - 190
Target Start/End: Original strand, 34685343 - 34685521
Alignment:
| Q |
14 |
ataatactcctctttaattatactcatatttttctctt--aggnnnnnnnntactcatgttttttattcatttatttcagtccactattccccaatggag |
111 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34685343 |
ataacactcctctttaattatactcatatttttctctctcagaaaaaaaaatactcatgttttttattcatttatttcagtccactattccccaatggag |
34685442 |
T |
 |
| Q |
112 |
ttgccatagttcaactaaacttattcaacttatgatggttccggtcatatttaaattgggacactctcaatcaattcaa |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34685443 |
ttgccatagttcaactaaacttattcaacttatgatggttccggtcatatttaaattgggacactctcaatcaattcaa |
34685521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University