View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17594_high_19 (Length: 310)
Name: NF17594_high_19
Description: NF17594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17594_high_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 261; Significance: 1e-145; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 1 - 265
Target Start/End: Original strand, 26755184 - 26755448
Alignment:
| Q |
1 |
ccatcgcagtcacatgctggtgtcgacaaacttgttcactgttcttatgcctcatttaggcttaagctaactataaattggaacctatggtgaaattctg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26755184 |
ccatcgcagtcacatgctggtgtcgacaaacttgttcactgttcttatgcctcatttaggcgtaagctaactataaattggaacctatggtgaaattctg |
26755283 |
T |
 |
| Q |
101 |
agtactaatgcttatattggttcctccacttgcaatttttgtatacaatttgagttttgcaatacaactttagttcagtatttaaagatgttataacaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26755284 |
agtactaatgcttatattggttcctccacttgcaatttttgtatacaatttgagttttgcaatacaactttagttcagtatttaaagatgttataacaac |
26755383 |
T |
 |
| Q |
201 |
atagtaatttattctcatcagatttacaattttgatatccaatagctcttgatctatttttagat |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26755384 |
atagtaatttattctcatcagatttacaattttgatatccaatagctcttgatctatttttagat |
26755448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 271 - 302
Target Start/End: Original strand, 26755473 - 26755504
Alignment:
| Q |
271 |
aactacctagcactgccgtcttatttcatctc |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
26755473 |
aactacctagcactgccgtcttatttcatctc |
26755504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University