View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17594_high_28 (Length: 241)
Name: NF17594_high_28
Description: NF17594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17594_high_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 22 - 228
Target Start/End: Complemental strand, 16789903 - 16789695
Alignment:
| Q |
22 |
gagacaagctttcattacttcagataattttttaatcaactatttcatttatttaattggtttcatgatttcactttaaatattgcattctgtacatttt |
121 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
16789903 |
gagacaagctt-cattacttcagataattttttaatcaactatttcatttatctaattggtttcatgatttctctttaaatattgcattctgtacatttt |
16789805 |
T |
|
| Q |
122 |
tgctaatatttatttgaacatggctatgttccttcgaaggataattta---attggaatccatacactaagtatttgagagtttaggtaattattttttc |
218 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
16789804 |
tgctaatacttatttgaacatggctatattccttcgaaggataatttaattattggaatccatacactccgtatttgagagtttaggtaattattttttc |
16789705 |
T |
|
| Q |
219 |
gattcatctc |
228 |
Q |
| |
|
|||||||||| |
|
|
| T |
16789704 |
gattcatctc |
16789695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University