View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17594_low_24 (Length: 265)
Name: NF17594_low_24
Description: NF17594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17594_low_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 11 - 225
Target Start/End: Original strand, 50458496 - 50458709
Alignment:
| Q |
11 |
aaaatgagtaagttgtagttatagcattaacatggtatataagaaaggtaattttgttttaaaaaataggttaaattggatattatgtccctttcattat |
110 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50458496 |
aaaatgagtaagttgtagt-atagcattaacatggtatataaaaaaggtaattttgtttaaaaaaataggttaaattggatattatgtccctttcattat |
50458594 |
T |
|
| Q |
111 |
tttattttggtctcataacttctaaatcgttcattttaatctctcaaacattctcacatcgatcaatttggtctcaaacactattccaccatattgtggg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| ||||||| | |
|
|
| T |
50458595 |
tttattttggtctcataacttctaaatcgttcattttaatctctcaaacattctctcatctatcaatttggtctcaaacactattccaccgtattgtgag |
50458694 |
T |
|
| Q |
211 |
agtatcgtcgtcgtt |
225 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
50458695 |
agtatggtcgtcgtt |
50458709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University