View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17594_low_33 (Length: 235)
Name: NF17594_low_33
Description: NF17594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17594_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 11 - 221
Target Start/End: Original strand, 46843585 - 46843795
Alignment:
| Q |
11 |
cagtgaagtgaattcaaaaccagagaacaaaactgttctgtttggatctcagttgaggattcagattcctccctttttaccaacaatttcaactttttct |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46843585 |
cagtgaagtgaattcaaaaccagagaacaaaactgttctgtttggatctcagttgaagattcagattcctccctttttaccaacaatttcaactttttct |
46843684 |
T |
 |
| Q |
111 |
tcttcatctgaatcatcacctttatctagaggtgatttcagcatcaacacaagaaattctcatttgggttcttcttctggaagcttttcactctctcctg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46843685 |
tcttcatctgaatcatcacctttatctagaggtgatttcagcatcaacacaagaaattctcatttgggttcttcttctggaagcttttcactctctcctg |
46843784 |
T |
 |
| Q |
211 |
tgggaaaatct |
221 |
Q |
| |
|
||||||||||| |
|
|
| T |
46843785 |
tgggaaaatct |
46843795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University