View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17595_high_6 (Length: 217)

Name: NF17595_high_6
Description: NF17595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17595_high_6
NF17595_high_6
[»] chr2 (1 HSPs)
chr2 (17-204)||(43792236-43792423)


Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 17 - 204
Target Start/End: Complemental strand, 43792423 - 43792236
Alignment:
17 ctttttagctaagcattgcacatggagttaaatgatttgacaaagaactaacgtgtttgttaaaattaatttgaagaacaactatggtttaactaaacac 116  Q
    ||||||| ||||||||||||||||||||||||||||||||  ||||||||||||| ||||||||||||||||||| ||| ||||||||||||||||||||    
43792423 ctttttatctaagcattgcacatggagttaaatgatttgaataagaactaacgtggttgttaaaattaatttgaaaaacgactatggtttaactaaacac 43792324  T
117 atgtctttgcgaagagattttaaaatgattaacataattcaaatccccctttgttgtgtttttccaacatattcaagtggtatcagtg 204  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||    
43792323 atgtctttgcgaaaagattttaaaatgattaacataattcaaatccccttttgtcgtgtttttccaacatattcaagtggtatcagtg 43792236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University