View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17595_low_4 (Length: 302)
Name: NF17595_low_4
Description: NF17595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17595_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 116 - 295
Target Start/End: Original strand, 38186819 - 38186998
Alignment:
| Q |
116 |
cttaccatcgagggtaaaatgtttggtgaaaggggtacgggggagaaggaaaattttgcatagagaaataatccaaaggaaaatgaaagaagcgattatg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38186819 |
cttaccatcgagggtaaaatgtttggtgaaaggggtacgggggagaaggaaaattttgcatagagaaataatccaaaggaaaatgaaagaagcgattatg |
38186918 |
T |
|
| Q |
216 |
agaatcaaggccatgaaggttgaaattcaaacaccaattcaatgattagggctcaaaatgaattgtttttattcatctca |
295 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38186919 |
agaatcaaggccatgaaggttgaaattgaaacaccaattcaatgattagtgctcaaaatgaattgtttttattcatctca |
38186998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University