View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17595_low_8 (Length: 217)
Name: NF17595_low_8
Description: NF17595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17595_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 17 - 204
Target Start/End: Complemental strand, 43792423 - 43792236
Alignment:
| Q |
17 |
ctttttagctaagcattgcacatggagttaaatgatttgacaaagaactaacgtgtttgttaaaattaatttgaagaacaactatggtttaactaaacac |
116 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
43792423 |
ctttttatctaagcattgcacatggagttaaatgatttgaataagaactaacgtggttgttaaaattaatttgaaaaacgactatggtttaactaaacac |
43792324 |
T |
|
| Q |
117 |
atgtctttgcgaagagattttaaaatgattaacataattcaaatccccctttgttgtgtttttccaacatattcaagtggtatcagtg |
204 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43792323 |
atgtctttgcgaaaagattttaaaatgattaacataattcaaatccccttttgtcgtgtttttccaacatattcaagtggtatcagtg |
43792236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University