View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17596_high_19 (Length: 441)
Name: NF17596_high_19
Description: NF17596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17596_high_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 397; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 397; E-Value: 0
Query Start/End: Original strand, 15 - 423
Target Start/End: Complemental strand, 42745902 - 42745494
Alignment:
| Q |
15 |
cataggccagaagaaatcaaatgcttgtgcattaaagttgatgaattggtttcatcagttcttctgaatgagaagatacacaccatgtcctggctctaca |
114 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42745902 |
cataggccagaagaaatcaaatgattgtgcattaaagttgatgaattggtttcatcagttcttctgaatgagaagatacacaccatgtcctggctctaca |
42745803 |
T |
 |
| Q |
115 |
atcatattatatgcaggagaatgcttataactaggagacaaagagaagctgaacttggagacaataagggctagcacaacctttagttcaaccattgcaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42745802 |
atcatattatatgcaggagaatgcttataactaggagacaaagagaagctgaacttggagacaataagggctagcacaacctttagttcaaccattgcaa |
42745703 |
T |
 |
| Q |
215 |
agttcttccccacgcacaaccgagtgccgattccaaatggcacatacgcttgtggaaacttgatagccttcgacacaccctcactgaacctttcgggttt |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42745702 |
agttcttccccacgcacaaccgagtgccgattccaaatggcacatacgcttgtggaaacttgatagccttagacacaccctcactgaacctttcgggttt |
42745603 |
T |
 |
| Q |
315 |
aaactcgttggaatctggtccccaaatttcaggatctctgtgcaaagttgggatcagagtccataagcaaacacctttgggaacattcaggtttcctatt |
414 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42745602 |
aaactcgttggaatctggtccccaaatttcaggatctctgtgcaaagttgggatcagagtccataagcaaacacctttgggaacattcaggcttcctatt |
42745503 |
T |
 |
| Q |
415 |
tggatatct |
423 |
Q |
| |
|
||||||||| |
|
|
| T |
42745502 |
tggatatct |
42745494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University