View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17596_high_26 (Length: 358)
Name: NF17596_high_26
Description: NF17596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17596_high_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 4e-94; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 14 - 208
Target Start/End: Complemental strand, 404279 - 404085
Alignment:
| Q |
14 |
cagcatatatagttgatccatttgttgaggaatttgaaatgaatcgtattcaatgtcgaggaagaaactgttgatggaatgaaaaccaacgagttctcgc |
113 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
404279 |
cagcatatatagttgaaccatttgttgaggaatttgaaatgaattgtattcaatgtcgaggaagaaactgttgatggaatgaaaaccaacgagttctcgc |
404180 |
T |
|
| Q |
114 |
tcaagaaacatggaggaaaaaatatggttgaaaagctgaagtctataacgggaacgaaaggccatagaggacgaatgttccatctcttggagaga |
208 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
404179 |
tcaagaaaaatggaggaaaaaatatggttgaaacgctgaagtctataacgggaacgaaaggccataggggacgaatgttccatctcttggagaga |
404085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 245 - 343
Target Start/End: Complemental strand, 404090 - 403992
Alignment:
| Q |
245 |
gagagaatgtggcaaatgatctcatctggtaaactgctcaacctgtctttgcgctgctcagacatcatcgttcgttcccgtgttttgtgctgaacaaac |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
404090 |
gagagaatgtggcaaatgatctcatctggtaaactgctcaacctgtctttgggctgctcagacatcatcgttcgttcccatgttttgtgctgaacaaac |
403992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 54 - 95
Target Start/End: Original strand, 975456 - 975497
Alignment:
| Q |
54 |
gaatcgtattcaatgtcgaggaagaaactgttgatggaatga |
95 |
Q |
| |
|
||||||||||||||||| |||| |||| |||||||||||||| |
|
|
| T |
975456 |
gaatcgtattcaatgtcaaggatgaaagtgttgatggaatga |
975497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University