View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17596_high_44 (Length: 293)
Name: NF17596_high_44
Description: NF17596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17596_high_44 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 143 - 278
Target Start/End: Complemental strand, 13317633 - 13317501
Alignment:
| Q |
143 |
cttgattgtcttgaataatcttcaaggaaagaagactctatgtgacttttgcttctttctatgatgtttgagaaagttctcaatctccggtattggctca |
242 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13317633 |
cttgattgtcttgaat---cttcaaggaaagaagactctatgtgacttttgcttctttctatgatgtttgagaaagttctcaatctccggtattggctca |
13317537 |
T |
|
| Q |
243 |
ctaatttccctaatccttgatgtaggtggtttttac |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
13317536 |
ctaatttccctaatccttgatgtaggtggtttttac |
13317501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University