View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17596_high_49 (Length: 258)
Name: NF17596_high_49
Description: NF17596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17596_high_49 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 30988583 - 30988371
Alignment:
| Q |
1 |
cgcttttggcactttggaaatgcatcccaatgcaagctgcaaaacttgatgatcgtttttgcaaagtacggtttgaacgtcttctatatgaagtgaagaa |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
30988583 |
cgcttttggcaccttggaaatgcatcccaatgcaagctgcaaaacttgatgatcgtttttgcaaagtacggtttgaacgtcttctatatgaaatgaagaa |
30988484 |
T |
 |
| Q |
101 |
attcctgggatgttctctgcttgttcatctacatcattttaaaacagcacagatcagacatgcactaatgtacaattgctttaatcttctggtgatgata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30988483 |
attcctgggatgttctctgcttgttcatctacatcattttaaaacagcacagatcagacatgcactaatgtacaattgctttaatcttctggtgatgata |
30988384 |
T |
 |
| Q |
201 |
tgcaatacatgaa |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
30988383 |
tgcaatacatgaa |
30988371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 79 - 120
Target Start/End: Complemental strand, 31002272 - 31002231
Alignment:
| Q |
79 |
gtcttctatatgaagtgaagaaattcctgggatgttctctgc |
120 |
Q |
| |
|
||||||||||||||| || ||||||||||||| ||||||||| |
|
|
| T |
31002272 |
gtcttctatatgaagagacgaaattcctgggacgttctctgc |
31002231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University