View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17596_high_55 (Length: 253)
Name: NF17596_high_55
Description: NF17596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17596_high_55 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 125 - 239
Target Start/End: Complemental strand, 56232326 - 56232208
Alignment:
| Q |
125 |
ctacgactaactcgtgtaatttggaaaatactaagttaggaaacaaaatatgcagcatgatttatgacgcaatgtttgaaattaataatgaaagaatag- |
223 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56232326 |
ctacgaccaactcgtgtaatttggaaaatactaagttaggaaacaaaatatgtagtatgatttatgacgcaatgtttgaaattaataatgaaagaatagg |
56232227 |
T |
 |
| Q |
224 |
---accttgaggatctctg |
239 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
56232226 |
caaaccttgaggatctctg |
56232208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 56232450 - 56232372
Alignment:
| Q |
1 |
tcaaagtccaattctgtgggactaatcgctcctgagtacgcagcaataatgttcacaccgggtgcggttacatccggct |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56232450 |
tcaaagtccaattctgtgggactaatcgctcctgagtacgcagcaataatgttcacaccgggtgcggttacatccggct |
56232372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 57; Significance: 7e-24; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 7 - 79
Target Start/End: Complemental strand, 39190259 - 39190187
Alignment:
| Q |
7 |
tccaattctgtgggactaatcgctcctgagtacgcagcaataatgttcacaccgggtgcggttacatccggct |
79 |
Q |
| |
|
||||||| ||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39190259 |
tccaattttgtgggactaaccgctcctgagtaggcagcaataatgttcacaccgggtgcggttacatctggct |
39190187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 145 - 225
Target Start/End: Complemental strand, 39218836 - 39218756
Alignment:
| Q |
145 |
ttggaaaatactaagttaggaaacaaaatatgcagcatgatttatgacgcaatgtttgaaattaataatgaaagaatagac |
225 |
Q |
| |
|
||||||||||||| ||||||||| |||||||| || ||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39218836 |
ttggaaaatactatgttaggaaataaaatatgtagtatgatttgtgacacaatgtttgaaattaataatgaaagaatagac |
39218756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 142 - 239
Target Start/End: Complemental strand, 39190098 - 39189998
Alignment:
| Q |
142 |
aatttggaaaatactaagttaggaaacaaaatatgcagcatgatttatgacgcaatgtttgaaattaataatgaaagaatag----accttgaggatctc |
237 |
Q |
| |
|
|||||||||||||| | ||||||||| |||||||| || ||||||| |||| || ||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39190098 |
aatttggaaaataccatgttaggaaataaaatatgtagtatgatttgtgacaca-tgtttgaaattaataatgaaagaataggcaaaccttgaggatctc |
39190000 |
T |
 |
| Q |
238 |
tg |
239 |
Q |
| |
|
|| |
|
|
| T |
39189999 |
tg |
39189998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University