View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17596_high_57 (Length: 251)
Name: NF17596_high_57
Description: NF17596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17596_high_57 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 6 - 251
Target Start/End: Complemental strand, 30688894 - 30688649
Alignment:
| Q |
6 |
atttcactctttccaactattaatattttttggtaaatgattggacgtaatgatttgtcttatgacttttcagtcggtgagcaaagaacgtgaagagttt |
105 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30688894 |
attttactctttccaactattaatattttttggtaaatgattggacgcaatgatttgtcttatgacttttcagtcggtgagcaaagaacgtgaagagttt |
30688795 |
T |
 |
| Q |
106 |
ctgaggcttgttaaaaaggaggtacgtagactgtagaattgatacgtctctaaggatgtagagaatacgttacagtgattcaaagtcttgaaactcaaat |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30688794 |
ctgaggcttgttaaaaaggaggtacgtagactgtagaattgatctgtctctaaggatgtagagaatacgttacagtgattcaaagtcttgaaactcaaat |
30688695 |
T |
 |
| Q |
206 |
gtcagtttctagttttttaagagcgtctattatgactgattgggct |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30688694 |
gtcagtttctagttttttaagagcgtctattatgactgattgggct |
30688649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University