View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17596_high_60 (Length: 238)
Name: NF17596_high_60
Description: NF17596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17596_high_60 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 2 - 222
Target Start/End: Complemental strand, 43485002 - 43484782
Alignment:
| Q |
2 |
tttggtcattaaatttagtgatgaatttagagtgatttcacattttctttctctaaatttctttcgttaattttatgtaactattatagtctataatctt |
101 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43485002 |
tttggtcactaaatttagtgatgaatttagagtgatttcacgttttctttctctaaatttcttccgttaattttatataactattatagtctataatctt |
43484903 |
T |
 |
| Q |
102 |
gtttccgtgatctaaaatttcttgatccatcgttgtctcttgcaatgattttatcaattatctttaatgctttgatccattatattgtgtgtgatgtgga |
201 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43484902 |
gtttccgtgagctaaaatttcttgatccgtcgctgtctcttgcaatgattttatcaattatctttaatgctttgatccattatgttgtgtgtgatgtgga |
43484803 |
T |
 |
| Q |
202 |
tgatgaagatatggtgcattg |
222 |
Q |
| |
|
|| |||||||||||||||||| |
|
|
| T |
43484802 |
tgttgaagatatggtgcattg |
43484782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University