View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17596_high_63 (Length: 235)
Name: NF17596_high_63
Description: NF17596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17596_high_63 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 6179579 - 6179348
Alignment:
| Q |
1 |
aaataaagcttagtagtataatgtgttcgtatatataagtggcaagaaaatgagattgagatagaggttctaggnnnnnnnnggtagtatattttagggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
6179579 |
aaataaagcttagtagtataatgtgttcgtatatataagtggcaagaaaatgagattgagatagaggttctaggtttattttggtagtagattttagggt |
6179480 |
T |
 |
| Q |
101 |
tatcaatattgtggggctagttgcatatggtattattgaaggtgagtagtatctataggacaaacaattcaagttgggaccatgaagggttgttaataat |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6179479 |
tacaaatattgtggggctagttgcatatggtattattgaaggtgactagtatctataggacaaacaattcaagttgggaccatgaaggattgttaataat |
6179380 |
T |
 |
| Q |
201 |
tgacgtagagtttgttgaacaaaggtgcaagt |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
6179379 |
tgacgtagagtttgttgaacaaaggtgcaagt |
6179348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University