View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17596_low_27 (Length: 357)
Name: NF17596_low_27
Description: NF17596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17596_low_27 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 10 - 126
Target Start/End: Complemental strand, 18539803 - 18539687
Alignment:
| Q |
10 |
aagaatatccaaatgaaatgcatgttttttgagcaaaaccaaaatcagtaacacagaaattgtgccattgtcggtatatgatgtcactttgtgccacctt |
109 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
18539803 |
aagaaaatccaaatgaaatgcatgttttttgagcaaaaccaaaatcagtaacacaaaaattgtgccattgtcggtatatcatgtcactttgtgccacctt |
18539704 |
T |
|
| Q |
110 |
ttctaaagaaaaatata |
126 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
18539703 |
ttctaaagaaaaatata |
18539687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 256 - 340
Target Start/End: Complemental strand, 18539431 - 18539347
Alignment:
| Q |
256 |
atacatcacgtcagccttacatttttcttcaattatctgctgccagtatattgcaactagatggagaacaagaactataaattgg |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
18539431 |
atacatcacgtcagccttacatttttcttcaattatctgctgctagtatattgcaactagatggagaacaagaactacaaattgg |
18539347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University