View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17596_low_59 (Length: 242)
Name: NF17596_low_59
Description: NF17596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17596_low_59 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 8 - 163
Target Start/End: Complemental strand, 43437218 - 43437065
Alignment:
| Q |
8 |
tgagatgaagatagtttgtgaataaaagtaaataatagttacactacactaaggatgtattactatatatggaatgtacatgtataaatatatgaatgaa |
107 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43437218 |
tgagaagaagatagtttgtgaataaaagtaaataatagttacactacactaaggatgtat-actatatatg-aatgtacatgtataaatatatgaatgaa |
43437121 |
T |
 |
| Q |
108 |
tactcacagtaatttgatttgatgtcataatcttcttgaggatgctacaagtactg |
163 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43437120 |
tactcacagtaatttgatttgatgtcatattcttcttgaggatgctacaagtactg |
43437065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University