View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17596_low_66 (Length: 234)
Name: NF17596_low_66
Description: NF17596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17596_low_66 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 14214765 - 14214995
Alignment:
| Q |
1 |
atatagttaagtaatttcaattgctcaatcaagaacgaactatttgtattaaaacttcgcaaaaacgaattgaaaacatgaagttttagtttttatgtcg |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||||||||||||||| |||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
14214765 |
atatagttaagtgatttcaattgctcaatcaagatcgaactatttgtattagaacttcgcaaaaacaaattgaaaacatgaagttatagtttttatgtcg |
14214864 |
T |
 |
| Q |
101 |
tctcgaagcataattcctaacnnnnnnnncactatttttggatctaaaagtatacttctagacatatgtgaggatatttagaaacctagggtggaaaaaa |
200 |
Q |
| |
|
|||| ||||||| ||||||| |||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14214865 |
tctcaaagcatacttcctaa---aaaaaacactatttttggatctgaaagtataattctagacatatgtgaggatatttagaaacctagggtggaaaaaa |
14214961 |
T |
 |
| Q |
201 |
gtatctcacgtgtgtgatagtatgcaatttattt |
234 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
14214962 |
gtatctcacatgtgtgatagtatgcaatttattt |
14214995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University