View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17596_low_67 (Length: 230)
Name: NF17596_low_67
Description: NF17596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17596_low_67 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 13 - 226
Target Start/End: Original strand, 47280111 - 47280324
Alignment:
| Q |
13 |
tgtctaaaacattcacttgaggggaaagaagttgtctggatattcttgctgttttgcaagtgatcaaaccatatggacattggcattccccgaagtatat |
112 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
47280111 |
tgtctaaaacattcacttgaggggaaataatttgtctggatatccttgctgttttgcaagtgatcaaaccatatggacattggcgttccccgaagtatat |
47280210 |
T |
|
| Q |
113 |
tctgattatcgggagttatggccaaactgcccgttcagaccagctggagtgttcagattaccaactaacccagcaggtgaaaaggatctgatagtattat |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47280211 |
tctgattatcgggagttatggccaaactgcccgttcagaccagctggagtgttcagattaccaactatcccagcaggtgaaaaggatctgatagtattat |
47280310 |
T |
|
| Q |
213 |
tgtgatgatgtcca |
226 |
Q |
| |
|
||||| ||||||| |
|
|
| T |
47280311 |
tgtgaaaatgtcca |
47280324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 57 - 134
Target Start/End: Original strand, 49059874 - 49059951
Alignment:
| Q |
57 |
cttgctgttttgcaagtgatcaaaccatatggacattggcattccccgaagtatattctgattatcgggagttatggc |
134 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| |||| |||||||||||| ||||||||||||| |
|
|
| T |
49059874 |
cttgctgttttgcaagtgatcaaaccctatggacattggcattccctgaagaatattctgattaacgggagttatggc |
49059951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 140 - 226
Target Start/End: Original strand, 49060037 - 49060123
Alignment:
| Q |
140 |
tgcccgttcagaccagctggagtgttcagattaccaactaacccagcaggtgaaaaggatctgatagtattattgtgatgatgtcca |
226 |
Q |
| |
|
|||||||| |||| || |||||||||||||||||||| || |||| ||||||||||||||||| || |||||||||| ||||||| |
|
|
| T |
49060037 |
tgcccgttaagactagttggagtgttcagattaccaattatcccactaggtgaaaaggatctgaaagcattattgtgaaaatgtcca |
49060123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University