View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17596_low_74 (Length: 204)
Name: NF17596_low_74
Description: NF17596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17596_low_74 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 10 - 189
Target Start/End: Complemental strand, 34140409 - 34140230
Alignment:
| Q |
10 |
catcatcattaccccaaccatcactagtgaaggacctatagcccatggaggaacacttgacaacaaaggagtgaaaaacaatgacaaaaagaaaaacaac |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34140409 |
catcatcattaccccaaccatcactagtgaaggacctatagcccatggaggaacacttgacaacaaaggagtgaaaaacaatgacaaaaagaaaaacaac |
34140310 |
T |
|
| Q |
110 |
ccgatgatcacagccgttaatcctgtcctaccaccttctctcatcccagctgatgattccacaaatgttgcagttgttgt |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
34140309 |
ccgatgatcacagccgttaatcctgtcctaccaccttctctcatcccagctgacgattccacaaatgttgcagttgttgt |
34140230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University