View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17597_high_19 (Length: 351)
Name: NF17597_high_19
Description: NF17597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17597_high_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 86 - 269
Target Start/End: Complemental strand, 52710257 - 52710074
Alignment:
| Q |
86 |
tacatttagcttcatccaaaatttctagtttaacttgaatctaaaacccacagatccaagacatgacggactagactgtttaaatatgatttannnnnnn |
185 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52710257 |
tacatttagcttcatccaaaattgctagtttaacttgaatctaaaacccacagatccaagacatgacggactagagtgtttaaatatgatttattttttt |
52710158 |
T |
 |
| Q |
186 |
gagagaaaatatgatttattattctctttgcaatatgatttgtatcatgtaaatcatactcccccattatttcatcattataag |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52710157 |
gagagaaaatatgatttattattctctttgcaatatgatttgtatcatgtaaatcatactcccccattatttcatcattataag |
52710074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 6 - 48
Target Start/End: Complemental strand, 52710337 - 52710295
Alignment:
| Q |
6 |
agaaattttgcgtgagagaatggtgtcttcatttaaggtggag |
48 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
52710337 |
agaaattttgcgtgagagaatagtgtcttcatttaaggtggag |
52710295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University