View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17597_high_39 (Length: 242)
Name: NF17597_high_39
Description: NF17597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17597_high_39 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 8 - 232
Target Start/End: Complemental strand, 25103069 - 25102845
Alignment:
| Q |
8 |
ggacatcatcaaaggatgtcatggacatggttcttgtgacccaatactttgacacattgaaggagattggcgcatcctcaaagtccaattctgtttttgt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25103069 |
ggacatcatcaaaggatgtcatggacatggttcttgtgacccaatactttgacacattgaaggagattggcgcatcctcaaagtccaattctgtttttgt |
25102970 |
T |
 |
| Q |
108 |
tccacatggaccaggtgttgtaaaagatatttcttcacaagtcagagatggtcttctccacgggaatgtcgctcggccttgaagtttgagacatgtcagt |
207 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25102969 |
tccacacggaccaggtgttgtaaaagatatttcttcacaagtcagagatggtcttctccatgggaatgtcgctcggccttgaagtttgagacatgtcagt |
25102870 |
T |
 |
| Q |
208 |
gtcgtgttttgtgtccccgtctgtg |
232 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
25102869 |
gtcgtgttttgtgtccccgtctgtg |
25102845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 22 - 89
Target Start/End: Original strand, 3205205 - 3205272
Alignment:
| Q |
22 |
gatgtcatggacatggttcttgtgacccaatactttgacacattgaaggagattggcgcatcctcaaa |
89 |
Q |
| |
|
||||||||||||||||| | ||||| |||||||| ||||| ||||||| ||||| ||||||||||| |
|
|
| T |
3205205 |
gatgtcatggacatggtgttggtgactcaatacttcgacaccatgaaggaaattggtgcatcctcaaa |
3205272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 17 - 77
Target Start/End: Original strand, 44632804 - 44632864
Alignment:
| Q |
17 |
caaaggatgtcatggacatggttcttgtgacccaatactttgacacattgaaggagattgg |
77 |
Q |
| |
|
|||| ||||||||||| ||||| ||||| || |||||||||||||| ||||| || ||||| |
|
|
| T |
44632804 |
caaaagatgtcatggatatggtccttgtcactcaatactttgacactttgaaagaaattgg |
44632864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University