View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17597_high_42 (Length: 237)
Name: NF17597_high_42
Description: NF17597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17597_high_42 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 11 - 222
Target Start/End: Complemental strand, 35345369 - 35345158
Alignment:
| Q |
11 |
aaaagtgaaaccattgtaacagtcgtgtatactctaacacacccttgtgaaaatgacaacttttcactaccaaataatcataatgctttcacctaaaaca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
35345369 |
aaaagtgaaaccattgtaacagtcgtgtatgctctaacacacccttgtgaatatgacaacttttcactaccaaataatcataatgctttcacctaagaca |
35345270 |
T |
 |
| Q |
111 |
attactccttattaaagatttatccnnnnnnnnnnnnnnnnnnnnacacatgatatgccttcattctcccacatcccttggtaaccattttcttcttgct |
210 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35345269 |
attactccttattaaagatttatccttttttatttttatttttttacacatgctatgccttcattctcccacatcccttggtaaccattttcttcttgct |
35345170 |
T |
 |
| Q |
211 |
ctttctcctttt |
222 |
Q |
| |
|
|||||||||||| |
|
|
| T |
35345169 |
ctttctcctttt |
35345158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University