View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17597_high_47 (Length: 230)
Name: NF17597_high_47
Description: NF17597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17597_high_47 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 3 - 215
Target Start/End: Original strand, 53681177 - 53681383
Alignment:
| Q |
3 |
ggtgaaaatttcaatggaacgcaataattagtctgccaccacatttccaaacataagtatattcatattcatattcacatgcaatttgagtgaacaaatg |
102 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
53681177 |
ggtgaaaatttcaatggaacgcgataattagtctgccaccacatttccaaacataagtatat------tcatattcacatgcaatttgagtgaacaaatg |
53681270 |
T |
 |
| Q |
103 |
tgtgtgattccttggcttattttggtatcaagaaatttcaagttcaacaaggaaatatctcaaaagaaaatggtgacataaatctaatgaaattttcaaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53681271 |
tgtgtgattccttggcttattttggtatcaagaaatttcaagttcaacaaggaaatatctcaaaagaaaatggtgacataaatctaatgaaattttcaaa |
53681370 |
T |
 |
| Q |
203 |
tagtactagtact |
215 |
Q |
| |
|
||||||||||||| |
|
|
| T |
53681371 |
tagtactagtact |
53681383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University