View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17597_high_49 (Length: 226)
Name: NF17597_high_49
Description: NF17597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17597_high_49 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 24 - 206
Target Start/End: Original strand, 50209183 - 50209365
Alignment:
| Q |
24 |
ctacggagatgcatcaacacacttgcactccacaactatgaataacaccgccatattaaatcagcagaagttttaatccatgacccgataaatcgccaga |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50209183 |
ctacggagatgcatcaacacacttgcactccacaattatgaataacaccgccatattaaatcagcagaagttttaatccatgacccgataaatcgccaga |
50209282 |
T |
|
| Q |
124 |
ggcatcagagactttgaacaacccatacctatatggaaaagtgaatttccatatttgactgataaaaacctaaagtaatccct |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50209283 |
ggcatcagagactttgaacaacccatacctatatggaaaagtgaatttccatatttgactgataaaaacctaaagtaatccct |
50209365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University