View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17597_low_13 (Length: 439)
Name: NF17597_low_13
Description: NF17597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17597_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 120; Significance: 3e-61; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 13 - 148
Target Start/End: Complemental strand, 31367527 - 31367392
Alignment:
| Q |
13 |
aaaatatatttatatatgtgtgagaatttggttgaacctgagaatttatttactacttccgtctgtacattaggcctgtcacacgggtggttctcataca |
112 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31367527 |
aaaaaatatttatatatgtgtgagaatttggttgaacctgagaatttatttactacttccgtctgtacattcggcctgtcacacgggtggttctcataca |
31367428 |
T |
|
| Q |
113 |
taacccataaataccatggtagaatcatatttcctt |
148 |
Q |
| |
|
|| || |||||||||||||||||||||||||||||| |
|
|
| T |
31367427 |
tatcctataaataccatggtagaatcatatttcctt |
31367392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 111; E-Value: 7e-56
Query Start/End: Original strand, 256 - 433
Target Start/End: Complemental strand, 31367290 - 31367113
Alignment:
| Q |
256 |
aattagatatcattcacaaggaactataaagattgatctttcgagttgagtaagataatgtctttttaatatattgatttgcctttcnnnnnnnnnnnnn |
355 |
Q |
| |
|
||||||||||| ||| |||| ||||| |||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
31367290 |
aattagatatctttcgcaagcaactacaaagattgatctttcgagttgagtaagataatatttttttaatatattgatttgcctttcaaaaataaaaaaa |
31367191 |
T |
|
| Q |
356 |
ttgacaaaggtaaacctttaccatttttaataaaaacaggaatgttcaccgttggactgggaacatattagacaatct |
433 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31367190 |
ttggcaaaggtaaacctttaccatttttaataaaaacaggaatgttcaccgttggactgggaacatattagacaatct |
31367113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University