View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17597_low_23 (Length: 330)
Name: NF17597_low_23
Description: NF17597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17597_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 15 - 313
Target Start/End: Original strand, 28090805 - 28091104
Alignment:
| Q |
15 |
actgtggaagaaacaggagagaggggtttcctagttaatggtgactgaattccaattctctttgcactttgtggtgtcttctttgctgaatgatcataaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28090805 |
actgtggaagaaacaggagagaggggtttcctagttaatggtgactgaattccaattctctttgcactttgtggtgtcttctttgctgaatgatcataaa |
28090904 |
T |
 |
| Q |
115 |
ccttagaggtaccctttcctgcataagccacaagtgacacaacgcatataaattttcaccttaga-nnnnnnnaaagacatgatacatgtggaatgagtt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
28090905 |
ccttagaggtaccctttcctgcataagccacaaatgacacaatgcatataaattttcaccttagattttttttaaagacatgatacatgtggaatgagtt |
28091004 |
T |
 |
| Q |
214 |
gaatggcatgctgtcttggttgtgttaccttttttgttagattgttgaataagagttgattgccttcgatcctgaagcattgcaccaccaacacaaaatt |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28091005 |
gaatggcatgctgtcttggttgtgttaccttttttgttagattgttgaataagagttgattgccttcgatcctgaagcattgcaccaccaacagaaaatt |
28091104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University