View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17599_high_8 (Length: 335)
Name: NF17599_high_8
Description: NF17599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17599_high_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 25 - 309
Target Start/End: Original strand, 14996646 - 14996930
Alignment:
| Q |
25 |
catcaggaggaaaagtaataacattgttcagactcaaattcttaacgtcaatgacctgtaaaacatcaccagttttagttccaaacaagccagccttctc |
124 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14996646 |
catcaggaggaaaagtaataacattgttaagactcaaattcttaacgtcaatgacctgtaaaacatcaccagttttagttccaaacaagccagccttctc |
14996745 |
T |
|
| Q |
125 |
aatgatgaacagctgctccttctcagtagtccagagcaaccgccaagttgccgacggggaatcgccggtggttactgtaccggtgccaagctcggccatt |
224 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
14996746 |
aatgatgaacagctgctctttctcagtagtccagagcaaccgccaagttgccgacagggaatcaccggtggttactaaaccggtgccaagctcggccatt |
14996845 |
T |
|
| Q |
225 |
gcatcgatcgcggtaacgatcgatgctagcttnnnnnnnnnnnnnngggtcttgaggccacggtcttggtcagagatgagggtga |
309 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14996846 |
gcatcgatcgcggtaacgatcgaagctagcttggtgggatttttttgggtcttgaggccacggtcttggtcagagatgagggtga |
14996930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University