View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1759_high_9 (Length: 235)
Name: NF1759_high_9
Description: NF1759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1759_high_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 15 - 217
Target Start/End: Original strand, 34895546 - 34895748
Alignment:
| Q |
15 |
ataaaatggaaaataaaaacctattttggcgatgcaacatactgtaaaattgatgacacgacagggcagtctaagttgcaatctgaaactgcagctggtc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34895546 |
ataaaatggaaaataaaaacctattttgacgatgcaacatactgtaaaattgatgacacgacagggcagtctaagttgcaatctgaaactgcagctggtc |
34895645 |
T |
 |
| Q |
115 |
gagtatctcgatatattattctgtcacaccaagcaggaattcgctttttctccccagaatcataccctgcaagattgtacggaagttatgctactgtcat |
214 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34895646 |
gagtatcacgatatattattctgtcacaccaagcaggaattcgctttttctccccagaatcataccctgcaagattgtacggaagttacgctactgtcat |
34895745 |
T |
 |
| Q |
215 |
gtt |
217 |
Q |
| |
|
||| |
|
|
| T |
34895746 |
gtt |
34895748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University