View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1759_low_6 (Length: 293)
Name: NF1759_low_6
Description: NF1759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1759_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 77; Significance: 9e-36; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 192 - 272
Target Start/End: Complemental strand, 9138107 - 9138027
Alignment:
| Q |
192 |
agaaggttacccaaaaacattgtaggattaacccaccaatcattagtatcgaaatcaaagctagactttcttactttcatc |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9138107 |
agaaggttacccaaaaacattgtaggattaacccaccaatcattagtatcgaaatcaaagctaaactttcttactttcatc |
9138027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 7 - 120
Target Start/End: Complemental strand, 9138295 - 9138179
Alignment:
| Q |
7 |
gaaatgaaataattgaatcataaaataataataataattattgannnnnnnnnnn---aacaagctaaaatagaattatatatataaaccaaccatcact |
103 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9138295 |
gaaaagaaataattgaatcataaaataataataataattattgagttctattttttttaataagctaaaatagaattatatatataaaccaaccatcact |
9138196 |
T |
|
| Q |
104 |
ctaaacacaacgtgtgc |
120 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
9138195 |
ctaaacacaacgtgtgc |
9138179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University