View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17600_high_5 (Length: 359)
Name: NF17600_high_5
Description: NF17600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17600_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 110 - 350
Target Start/End: Original strand, 29281853 - 29282090
Alignment:
| Q |
110 |
tacatgagatacgagggtgtgttatatatggcggctgaaagagaaaaaggatagtaataaataacact--------tggaactctcaagtatgattcgat |
201 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | |||||||||||||||||||| |
|
|
| T |
29281853 |
tacatgagatacaagggtgtgttatatatggcggctgaaagagaaaaaggatagtaataaataacactaacaatccttggactctcaagtatgattcgat |
29281952 |
T |
 |
| Q |
202 |
gacactaaaatcgttgttactttcatagccctgttcaactccaatcacaaatcttgctcacacacacatgcctttaatatcaacaatcaaggtttagatc |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| || |
|
|
| T |
29281953 |
gacactaaaatcgttgttactttcatagccctgttcaactccaatcacaaatcttgctcacccacacatgcctttaatatcaacaatcaggg-------- |
29282044 |
T |
 |
| Q |
302 |
atctttatttctcaaaagatggaggtgtccaacactataaatttaggat |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29282045 |
---tttatttctcaaaagatggaggtgtccaacactataaatttaggat |
29282090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 31 - 64
Target Start/End: Original strand, 29281774 - 29281807
Alignment:
| Q |
31 |
ggtgattttctatcttgttcttgctagatactat |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
29281774 |
ggtgattttctatcttgttcttgctagatactat |
29281807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University