View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17600_low_8 (Length: 298)
Name: NF17600_low_8
Description: NF17600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17600_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 17 - 295
Target Start/End: Original strand, 53040110 - 53040388
Alignment:
| Q |
17 |
aaataataatgaatgcatacctgagatctggcaaagtctcgaagatctgatggtttgaaggaatctgaatcacattttatattgggagtctgcgttgtaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53040110 |
aaataataatgaatgcatacctgagatctggcaaagtctcgaagatctgatggtttgaaggaatctgaatcacattttatattgggagtctgcgttgtaa |
53040209 |
T |
|
| Q |
117 |
gcatatagtcactgtaaacagaagctaagaatgcagatgcaacacgatgctgcaaagcgttccattcactcacccatatcagaccatctatatnnnnnnn |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53040210 |
gcatatagtcactgtaaacagaagctaagaatgcagatgcaacaggatgctgcaaagcgttccattcactcacccatatcagaccatctatataaaagaa |
53040309 |
T |
|
| Q |
217 |
nnnnnnnnntgtaattagacaacatattgcagtagaaatatattactaaaaatggaatttccatagtctgtgctcctcc |
295 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
53040310 |
aaagaaaaatgcaattagacaacatattgcagtagaaatatattactaaaaatggaatttccatagtttgtgttcctcc |
53040388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University