View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17601_high_12 (Length: 210)
Name: NF17601_high_12
Description: NF17601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17601_high_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 19 - 177
Target Start/End: Complemental strand, 2179825 - 2179667
Alignment:
| Q |
19 |
cgacctgcgaggagcttcaattgtttagccgccatagccacttcaacaactgtgaacactttctctaatattcctttcatgggatttgtcagtctacctt |
118 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2179825 |
cgacctgcgaggagcttcaattgcttagccgccatagccacttcaacaactgtgaacactttctctaatattcctttcatgggatttgtcagtttacctt |
2179726 |
T |
|
| Q |
119 |
gcacaataaaaatgtaagagagaattgtgttactgccatttagtactatttttctgaag |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2179725 |
gcacaataaaaatgtaagagagaattgtgttactgccatttagtactatttttctgaag |
2179667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University