View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17601_low_11 (Length: 234)
Name: NF17601_low_11
Description: NF17601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17601_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 35909210 - 35908996
Alignment:
| Q |
1 |
gctctaagcatgactggtggaaacattgatgttgcatgccatgaaaactcgaaatgaagctcaagaatctataaaatctaagaaaacgatgaatcaacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35909210 |
gctctaagcatgactggtggaaacattgatgttgcatgccatgaaaactcgatatgaagctcaagaatctataaaatctaagaaaacgatgaatcaacaa |
35909111 |
T |
 |
| Q |
101 |
gaaattgttgtgaataaaaagcaattatgaaaaattgcaacgaagatgtaaagaaaatcttatgattctgcaagaaccttcaagtatgcggaagcagtct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35909110 |
gaaattgttgtgaataaaaagcaattatgaaaaattgcaacgaagatgtaaagaaaatcttatgattctgcaagaaccttcaagtatgcggaagcagtct |
35909011 |
T |
 |
| Q |
201 |
cgaaaggctcgtgat |
215 |
Q |
| |
|
||||| |||| |||| |
|
|
| T |
35909010 |
cgaaaagctcatgat |
35908996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University