View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17601_low_13 (Length: 210)

Name: NF17601_low_13
Description: NF17601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17601_low_13
NF17601_low_13
[»] chr3 (1 HSPs)
chr3 (19-177)||(2179667-2179825)


Alignment Details
Target: chr3 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 19 - 177
Target Start/End: Complemental strand, 2179825 - 2179667
Alignment:
19 cgacctgcgaggagcttcaattgtttagccgccatagccacttcaacaactgtgaacactttctctaatattcctttcatgggatttgtcagtctacctt 118  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
2179825 cgacctgcgaggagcttcaattgcttagccgccatagccacttcaacaactgtgaacactttctctaatattcctttcatgggatttgtcagtttacctt 2179726  T
119 gcacaataaaaatgtaagagagaattgtgttactgccatttagtactatttttctgaag 177  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2179725 gcacaataaaaatgtaagagagaattgtgttactgccatttagtactatttttctgaag 2179667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University