View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17602_high_4 (Length: 272)
Name: NF17602_high_4
Description: NF17602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17602_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 126 - 257
Target Start/End: Complemental strand, 5644755 - 5644624
Alignment:
| Q |
126 |
ctcagcaacaatgccgcgtaaacgtgttcgtcaaccatcggaacaacaacaaaacgacgccgttaatcgttctactcaacgcaagaaacctaaaaaatct |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5644755 |
ctcagcaacaatgccgcgtaaacgtgttcgtcaaccatcggaacaacaacaaaacgacgccgttaatcgttctactcagcgcaagaaacctaaaaaatct |
5644656 |
T |
 |
| Q |
226 |
ccggtggttgaagaagaactggtttctcttat |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
5644655 |
ccggtggttgaagaagaactggtttctcttat |
5644624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 15 - 127
Target Start/End: Complemental strand, 5644914 - 5644801
Alignment:
| Q |
15 |
aattaagtggaatattcaattaattctcccgctcttgttgcaaaacttcaattcaaaacagctttctacaatcgc-attttcttcactcgtttcactgct |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5644914 |
aattaagtggaatattcaattaattctcccgctcttgttgcaaaacttcaattcaaaacagctttctacaatcgcttttttcttcactcgtttcactgct |
5644815 |
T |
 |
| Q |
114 |
gctcttcactatct |
127 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
5644814 |
gctcttcactatct |
5644801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University