View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17602_low_6 (Length: 256)
Name: NF17602_low_6
Description: NF17602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17602_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 66; Significance: 3e-29; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 25524092 - 25524023
Alignment:
| Q |
1 |
atcatgatgccttataatgtgtctcatttttaaaattgatttaatgcttttgctatttatgacctctcaa |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
25524092 |
atcatgatgccttataatgtgtctcatttttaaaattgatttaatgcttttgctattcatgacctctcaa |
25524023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 2 - 113
Target Start/End: Complemental strand, 25538792 - 25538665
Alignment:
| Q |
2 |
tcatgatgccttataatgtgtctcattttt-aaaattga---------tttaatgcttttgctatttatgacctctcaatttca------tgtatgtgta |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |||||||||||| |||| ||||||||||||||||| ||||| |||| |
|
|
| T |
25538792 |
tcatgatgccttataatgtgtctcattttttaaaattgagatgcctgatttaatgctttttgtattcatgacctctcaatttcaatttcatgtatatgta |
25538693 |
T |
|
| Q |
86 |
ctttgttgggaactttgtttctgtccaa |
113 |
Q |
| |
|
||||||||||||||||| |||||||||| |
|
|
| T |
25538692 |
ctttgttgggaactttgattctgtccaa |
25538665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 216 - 248
Target Start/End: Complemental strand, 25524017 - 25523985
Alignment:
| Q |
216 |
cactggaacagtgttttctatctcatgatgatg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
25524017 |
cactggaacagtgttttctatctcatgatgatg |
25523985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University