View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17603_high_9 (Length: 285)
Name: NF17603_high_9
Description: NF17603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17603_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 5e-62; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 40 - 164
Target Start/End: Original strand, 19890108 - 19890232
Alignment:
| Q |
40 |
tgttgttgttattgcttcctgtttctgttactgtatttgaatgactcaagtagaaagtgaagaaaagagtacaatctattgaacagtttaggttggtccc |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19890108 |
tgttgttgttattgcttcctgtttctgttactgtgtttgaatgactcaagtagaaagtgaagaaaagagtacaatctattgaacagtttaggttggtccc |
19890207 |
T |
 |
| Q |
140 |
taatactatatgataataactcctc |
164 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
19890208 |
taatactatatgataataactcctc |
19890232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 276
Target Start/End: Original strand, 19890292 - 19890344
Alignment:
| Q |
224 |
gttgggttttaattgtttgatacttgtgttgttttcattgatgttgatgatgt |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19890292 |
gttgggttttaattgtttgatacttgtgttgttttcattgatgttgatgatgt |
19890344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University