View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17604_high_24 (Length: 212)
Name: NF17604_high_24
Description: NF17604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17604_high_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 51 - 196
Target Start/End: Complemental strand, 42056365 - 42056220
Alignment:
| Q |
51 |
gtattcaagtttataggttgttgcacagtttgggatagataagttacaattgttgtaatcatatttgagatagatagttaatacattttattggtgggat |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42056365 |
gtattcaagtttataggttgttgcacagtttgggatagataagttacaattgttgtaatcatatttgagatagatagttaatacattttattggtgggat |
42056266 |
T |
 |
| Q |
151 |
ttttctttggaagtaggtacttgtgtgttctaccactttctctgtg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42056265 |
ttttctttggaagtaggtacttgtgtgttctaccactttctctgtg |
42056220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University