View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17604_low_17 (Length: 302)
Name: NF17604_low_17
Description: NF17604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17604_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 6e-77; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 23 - 196
Target Start/End: Complemental strand, 3746367 - 3746195
Alignment:
| Q |
23 |
tcttttgtcctttttagttcacttttctccctctatatttggtgtcttataaacaaacccctcttagctacacttcattcatcttccattattctcttct |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
3746367 |
tcttttgtcctttttagttcacttttctccctctatacttgttgtcttataaacaaacccctcttggctacacttcattcatcttccattattctcttct |
3746268 |
T |
|
| Q |
123 |
ctccttcactactttggcttctctagagttagcatcaaaatcactcttaaccccaccaccatgcctacccaaca |
196 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3746267 |
ctccttcactattttggtttctctagagttagcatcaaaatcactc-taaccccaccaccatgcctacccaaca |
3746195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 255 - 295
Target Start/End: Complemental strand, 3746136 - 3746096
Alignment:
| Q |
255 |
tcaccatcatttgaaaaagaagaaacttatgattttcttcg |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3746136 |
tcaccatcatttgaaaaagaagaaacttatgattttgttcg |
3746096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University