View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17605_high_21 (Length: 288)
Name: NF17605_high_21
Description: NF17605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17605_high_21 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 27 - 288
Target Start/End: Complemental strand, 12683814 - 12683553
Alignment:
| Q |
27 |
tgccggtgtagttgccgccgcttactgccactttttacaacagtccatgcactcttttagcccctacctagagcctcattcaatgattaattacaatcat |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12683814 |
tgccggtgtagttgccgccgcttactgccactttttacaacagtccatgcactcttttagcccctacctagagcctcattcaatgattaattacaatcat |
12683715 |
T |
|
| Q |
127 |
tattttcattgaggtggcggtggtttgttggcaaccacttcataattgtcaataccttcgtcttcgtcctcgtcatcatcaccgtcatcatcgtcataat |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12683714 |
tattttcattgaggtggcggtggtttgttggcaaccacttcataattgtcaataccttcgtcttcgtcctcgtcatcatcaccgtcatcatcgtcataat |
12683615 |
T |
|
| Q |
227 |
attcttcttcatctcgaagcggctgatcatcccccgtctcagcttgctccatggccacatcc |
288 |
Q |
| |
|
||||||||||||||||| ||||| |||||| | | |||||||||| |||||||| ||||||| |
|
|
| T |
12683614 |
attcttcttcatctcgatgcggccgatcattctcagtctcagcttcctccatggtcacatcc |
12683553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University