View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17605_high_22 (Length: 275)
Name: NF17605_high_22
Description: NF17605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17605_high_22 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 260
Target Start/End: Complemental strand, 12683615 - 12683356
Alignment:
| Q |
1 |
tattcttcttcatctcgacgcggctgatcattctcagtctcagcttcctccatggtcacatccgccccggctgctggtggcacctgttgctgtggaggcc |
100 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12683615 |
tattcttcttcatctcgatgcggccgatcattctcagtctcagcttcctccatggtcacatccgccccggctgctggtggcacctgttgctgtggaggcc |
12683516 |
T |
 |
| Q |
101 |
actgctgctccggctgaaccatcaacggtgccatcatcgttccctcaggcctcgacgcagcagcagctgcaccctccaccttgttcttctgcctgtatag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12683515 |
actgctgctccggctgaaccatcaacggtgccatcatcgttccctcaggcctcgacgcagcagcagctgcaccctccaccttgttcttctgcctgtatag |
12683416 |
T |
 |
| Q |
201 |
agcatcaagttggtgaaagtaaggacatgtctttgaatcttctggcctcttcttgttgct |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12683415 |
agcatcaagttggtgaaagtaaggacatgtctttgaatcttctggcctcttcttgttgct |
12683356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 98 - 132
Target Start/End: Original strand, 44553171 - 44553205
Alignment:
| Q |
98 |
gccactgctgctccggctgaaccatcaacggtgcc |
132 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
44553171 |
gccattgctgctccggctgaaccatcaacggtgcc |
44553205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University