View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17605_high_23 (Length: 274)
Name: NF17605_high_23
Description: NF17605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17605_high_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 20 - 266
Target Start/End: Complemental strand, 36939549 - 36939303
Alignment:
| Q |
20 |
ttggtatcgtcattaaacacaaattaatgtggccattccttaattcacaaattgtgtacaggataaaatacgtacgtaccaaaccaaaatagtgcttgat |
119 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36939549 |
ttggtatcgtcattaaacactaattaatgtggccattccttaattcacaaattgtgtacaggataaaatacgtacgtaccaaaccaaaatagtgcttgat |
36939450 |
T |
 |
| Q |
120 |
atgcaaaatcttttttgtcnnnnnnncaaaaggtatatgcaaatttgattccaaaacatcatcaaccatgtattgtcaacgatgccatcacgtatgacat |
219 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36939449 |
atgcaaaatcttttttgtcaaaaaaataaaaggtatatacaaatttgattccaaaacatcatcaaccatgtattgtcaacgatgccatcacgtatgacat |
36939350 |
T |
 |
| Q |
220 |
ccttttatgacaaaacaatgtcggttgttttaaggctatcctatgct |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36939349 |
ccttttatgacaaaacaatgtcggttgttttaaggctatcctatgct |
36939303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University