View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17605_high_34 (Length: 236)
Name: NF17605_high_34
Description: NF17605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17605_high_34 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 11382271 - 11382154
Alignment:
| Q |
1 |
ctccttacaaattgttcgaaagaatcttaattcgattctcgacttaaattgtgtgcttgcacaatatgtattgtcttttaaaccttatcttactaatatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11382271 |
ctccttacaaattgttcgaaagaatcttaattcgattctcgacttaaattgtgtgcttgcacaatatgtattgtcttttaaaccttatcttactaatatt |
11382172 |
T |
|
| Q |
101 |
gccatattaattgggtgc |
118 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
11382171 |
gccatattaattgggtgc |
11382154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 168 - 221
Target Start/End: Complemental strand, 11382104 - 11382051
Alignment:
| Q |
168 |
aaaagttgtaaaagttgcgaaggcaaaggagccatcgaatgtccaggatgtaag |
221 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11382104 |
aaaagctgtaaaagttgcgaaggcaaaggggccatcgaatgtccaggatgtaag |
11382051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University