View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17605_high_35 (Length: 235)
Name: NF17605_high_35
Description: NF17605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17605_high_35 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 102 - 216
Target Start/End: Original strand, 52738959 - 52739074
Alignment:
| Q |
102 |
aagtgttgccggttttggttttcaatccaccatggttacatttagtctctattgatgaaattgagaagaaagtaacacatgcaaagcttcaatc-tgaat |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52738959 |
aagtgttgtcggttttggttttcaatccaccatggttacatttagtctctattgatgaaattgagaagaaagtaacacatgcaaagcttcaatcatgaat |
52739058 |
T |
|
| Q |
201 |
aaatttgagaactagt |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
52739059 |
aaatttgagaactagt |
52739074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University