View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17605_low_16 (Length: 358)
Name: NF17605_low_16
Description: NF17605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17605_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 333; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 17 - 353
Target Start/End: Original strand, 41705406 - 41705742
Alignment:
| Q |
17 |
caccacaaccaactctctctcccactctcaccaggctccgattacactctctccttcaacctcggaccccactcccaacccataactctctacatggaca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705406 |
caccacaaccaactctctctcccactctcaccaggctccgattacactctctccttcaacctcggaccccactcccaacccataactctctacatggaca |
41705505 |
T |
 |
| Q |
117 |
caggaagtgaccttgtttggttcccatgcacaccgttcaactgcatcctctgtgaattaaaacccaagcttacctcggatccctctccccctaccaacat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705506 |
caggaagtgaccttgtttggttcccatgcacaccgttcaactgcatcctctgtgaattaaaacccaagcttacctcggatccctctccccctaccaacat |
41705605 |
T |
 |
| Q |
217 |
ctcccacagcacccccatttcatgcaactcccatgcatgctctgtagcacacagttccaccccctcttccgatctatgcacaatggctcattgcccttta |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705606 |
ctcccacagcacccccatttcatgcaactcccatgcatgctctgtagcacacagttccaccccctcttccgatctatgcacaatggctcattgcccttta |
41705705 |
T |
 |
| Q |
317 |
gactccattgaaaccaaagactgcggttcatctcact |
353 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41705706 |
gactccattgaaaccaaagactgcggttcatttcact |
41705742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 92 - 172
Target Start/End: Complemental strand, 3744418 - 3744338
Alignment:
| Q |
92 |
caacccataactctctacatggacacaggaagtgaccttgtttggttcccatgcacaccgttcaactgcatcctctgtgaa |
172 |
Q |
| |
|
|||| |||||| ||||||||||||||||| || ||||||||||||||||| || |||| ||| | ||||| ||||||||| |
|
|
| T |
3744418 |
caactcataacactctacatggacacaggtagcgaccttgtttggttcccttgttcacctttcgaatgcattctctgtgaa |
3744338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University